Advertisements
Advertisements
प्रश्न
What is the function of SSBP?
उत्तर
Single strand DNA binding proteins (SSBPs) are important during DNA synthesis as they prevent the coiling of the separated DNA strands.
APPEARS IN
संबंधित प्रश्न
Semiconservative mechanism of DNA was detected using:
Differentiate - Leading stand and lagging strand.
Identify the direction of DNA replication in eukaryotes.
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
At the point of origin, enzyme endonuclease nicks one of the strands of DNA by breaking the ______
Which of the following is present at the sticky ends of a fragmented DNA molecule?
In a segment of DNA with 10 base pairs, the numbers of sugar molecules are _________.
Wobble position means:
Characteristics unique to DNA are ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
