Advertisements
Advertisements
प्रश्न
Describe the process of transcription in bacteria
उत्तर
Transcription has three steps—initiation, elongation, and termination.
Initiation:
RNA polymerase binds with the promoter to initiate the process of transcription. Association with the initiation factor (σ) alters the specificity of RNA polymerase to initiate transcription.
Elongation:
RNA polymerase uses nucleoside triphosphate as the substrate, and polymerisation occurs according to complementarity.
Termination:
Termination occurs when the termination factor (rho) alters the specificity of RNA polymerase to terminate transcription. As the RNA polymerase proceeds to perform elongation, a short stretch of RNA remains bound to the enzyme. As the enzyme reaches the termination region, this nascent RNA falls off and transcription is terminated.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Briefly describe the following:
Transcription
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
What is the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?