Advertisements
Advertisements
प्रश्न
How do m-RNA, t-RNA and ribosomes help in the process of translation?
उत्तर
Role of m-RNA, t-RNA and ribosomes in protein synthesis:
(i) m-RNA: The messenger RNA brings coded information from DNA and takes part in its translation by bringing amino acids in a particular sequence during the synthesis of a polypeptide. The same m-RNA can be reused many times.
(ii) t-RNA: They transfer RNAs which pick up particular amino acids in the process called charging, and they carry them to m-RNA over particular codons corresponding to their anticodons. Each t-RNA has an area for coming in contact with ribosome and the enzyme amino acyl tRNA synthetase.
(iii) Ribosomes: Ribosomes are protein factories. Each ribosome has two subunits— smaller and larger subunits. The larger subunit has a groove for pushing out the newly formed polypeptide and for protecting the same from cellular enzymes. The smaller subunit fits like a cap over the larger one and leaves a tunnel for m-RNA. The smaller subunit has a point for recognising m-RNA and binding area for initiation factors.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
How is Prokaryotic Transcription process different in eukaryotes?
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Which is not involved in protein synthesis?
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______