Advertisements
Advertisements
प्रश्न
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
उत्तर
The Meselson and Stahl experiment is as follows:
- They cultured E. coli bacteria in the medium containing 14N (light nitrogen) and obtained an equilibrium density gradient band by using 6M CsCl2. The position of this band was recorded.
- E. coli cells were then transferred to a 15N medium (heavy isotopic nitrogen) and allowed to replicate for several generations. At equilibrium point density gradient band was obtained, by using 6M CsCl2. The position of this band was recorded.
- The heavy DNA (15N) molecule can be distinguished from normal DNA by centrifugation in a 6M Caesium chloride (CsCl2) density gradient. The density gradient value of 6M CsCl2 and 15N DNA is almost the same. Therefore, at the equilibrium point, 15N DNA will form a band. In this, both strands of DNA are labelled with 15N.
- Such E. coli cells were then transferred to another medium containing 14N i.e. normal (light) nitrogen. After the first generation, the density gradient band for 14N 15N was obtained and its position was recorded. After the second generation, two density gradient bands were obtained - one at 14N 15N position and the other at 14N position.
- The position of bands after two generations clearly proved that DNA replication is semiconservative.
संबंधित प्रश्न
What is the correct sequence of the stages in bacteriophage lytic cycle?
(A) Attachment, Penetration, Lysis, Multiplication
(B) Attachment, Penetration, Multiplication, Lysis
(C) Lysis, Penetration, Multiplication, Attachment
(D) Attachment, Lysis, Multiplication, Penetration
Semiconservative mechanism of DNA was detected using:
During DNA replication, the separated strands of DNA are prevented from recoiling by
Okasaki fragments are joined together by ______.
Which of the following term correctly describes the movement of ribosome on the mRNA?
Which of the following is present at the sticky ends of a fragmented DNA molecule?
Select the mis-matched pair.
Okazaki segments are formed during ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?