Advertisements
Advertisements
Question
Define Heterochromatin.
Solution
Heterochromatin is a genetically and transcriptionally inactive, condensed, and strongly staining region of chromosomes.
APPEARS IN
RELATED QUESTIONS
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
Which enzyme does remove supercoils from replicating DNA?
Which of the following statements is not true about DNA replication in eukaryotes?
Differentiate - Leading stand and lagging strand.
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
In which direction polymerization of DNA nucleotides occurs during the synthesis of lagging strand?
Which of the following is the function of single-strand binding proteins?
______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.
Match the following column.
| Column - I | Column - II |
| (A) DNA structure | 1. Muller and stadder |
| (B) Semiconservative replication of DNA | 2. Beadle and partum |
| (C) One gene-one enzyme theory | 3. Watson and crick |
| (D) Induction of mutation | 4. Massillon and stahl |
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
