Advertisements
Advertisements
Question
What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?
Solution
Wastson and Crick had the following informations which helped them to develop a model of DNA.
- Chargaffs’ Law suggesting A = T, and C = G.
- Wilkins and Rosalind Franklin’s work on DNA crystal’s X-ray diffraction studies about DNA’s physical structure.
- Watson and crick proposed
- How complementary bases may pair
- Semi-conservative replication and
- Mutation through tautomerism
APPEARS IN
RELATED QUESTIONS
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
Meselson and Stahl’s experiment proved ____________.
DNA replication begins at specific sites situated on the molecule. Such sites are called ____________.
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Select the mis-matched pair.
Extension of the plasma membrane in a prokaryotic cell is ______.
Okazaki segments are formed during ______.
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
