Advertisements
Advertisements
प्रश्न
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
उत्तर
a) Replication fork
b)
c) Deoxy nucleotide, triphosphate acts as a energy source for replication. DNA polymerase is used for replication.
d) mRNA contacting information for protein synthesis will developed from DNA strand having polariy 5 ’ → 3 ’
संबंधित प्रश्न
_______ enzymes are used as biological scissors in r-DNA technology.
(A) Restriction endonucleases
(B) DNA ligases
(C) DNA polymerases
(D) Reverse transcriptases
What is the correct sequence of the stages in bacteriophage lytic cycle?
(A) Attachment, Penetration, Lysis, Multiplication
(B) Attachment, Penetration, Multiplication, Lysis
(C) Lysis, Penetration, Multiplication, Attachment
(D) Attachment, Lysis, Multiplication, Penetration
Very Short Answer Question:
When does DNA replication takes place?
Long Answer Question:
Explain the process of DNA replication.
Which of the following statements is not true about DNA replication in eukaryotes?
Meselson and Stahl’s experiment proved ____________.
Differentiate - Leading stand and lagging strand.
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
For which of the following purpose agarose gel electrophoresis technique is used?
Complementary strands of DNA molecule are (i) and bound by (ii).
When DNA directs the synthesis of chemical molecules other than itself, then such functions of DNA are known as ______.
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Read the following statements and select the correct option.
Statement I: DNA replication is continuous on leading strand while on the lagging strand it is discontinuous.
Statement II: DNA polymerase cannot initialize polymerization without a primer.
Which one of the following can form a nucleotide of DNA?
In DNA molecule, pairing between two complementary nucleotides takes place by ________ bonds.
Match the following column.
| Column - I | Column - II |
| (A) DNA structure | 1. Muller and stadder |
| (B) Semiconservative replication of DNA | 2. Beadle and partum |
| (C) One gene-one enzyme theory | 3. Watson and crick |
| (D) Induction of mutation | 4. Massillon and stahl |
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
In prokaryotes, the primers of lagging strands are removed by ______.
