हिंदी
तमिलनाडु बोर्ड ऑफ सेकेंडरी एज्युकेशनएचएससी विज्ञान कक्षा १२

If the coding sequence in a transcription unit is written as follows: 5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA. - Zoology

Advertisements
Advertisements

प्रश्न

If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.

एक पंक्ति में उत्तर

उत्तर

mRNA sequence is 3’ACGUACGUACGUUCGUACGUACGUACG5’.

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८६]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 31. | पृष्ठ ८६
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 31. | पृष्ठ ८९

संबंधित प्रश्न

Describe the process of transcription in bacteria


How do m-RNA, t-RNA and ribosomes help in the process of translation?


Explain the process of transcription in prokaryotes.


State the aim and describe Messelson and Stahl’s experiment.


Explain the role of initiator tRNA in the initiation of protein synthesis.


What are introns?


Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule


What is the central dogma?


Explain the mechanism of transcription in a prokaryotic cell.


A mRNA molecule is produced by ____________.


How is the two stage process of protein synthesis advantageous?


DNA template sequence of CTGATAGC is transcribed over mRNA as ______.


Which is not involved in protein synthesis?


If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.


The process of copying genetic information from one strand of DNA to RNA is termed as ______.


In a cell, DNA transcription is halted when ______ 


Read the following and answer from given below:

The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.

Which ion is essential for the association of both units of the ribosome at the time of protein formation?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×