Advertisements
Advertisements
प्रश्न
A mRNA molecule is produced by ____________.
विकल्प
Replication
Transcription
Duplication
Translation
उत्तर
A mRNA molecule is produced by Transcription.
संबंधित प्रश्न
How do m-RNA, t-RNA and ribosomes help in the process of translation?
State the aim and describe Messelson and Stahl’s experiment.
How is Prokaryotic Transcription process different in eukaryotes?
Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
What is the central dogma?
Which of the following is the correct sequence of event with reference to the central dogma?
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
Which is not involved in protein synthesis?
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
