हिंदी
तमिलनाडु बोर्ड ऑफ सेकेंडरी एज्युकेशनएचएससी विज्ञान कक्षा १२

A mRNA molecule is produced by ____________. - Zoology

Advertisements
Advertisements

प्रश्न

A mRNA molecule is produced by ____________.

विकल्प

  • Replication

  • Transcription

  • Duplication

  • Translation

MCQ
रिक्त स्थान भरें

उत्तर

A mRNA molecule is produced by Transcription.

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८४]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 3. | पृष्ठ ८४
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 3. | पृष्ठ ८७

संबंधित प्रश्न

How do m-RNA, t-RNA and ribosomes help in the process of translation?


State the aim and describe Messelson and Stahl’s experiment.


How is Prokaryotic Transcription process different in eukaryotes?


Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.


Explain the role of initiator tRNA in the initiation of protein synthesis.


What are introns?


What is the central dogma?


Which of the following is the correct sequence of event with reference to the central dogma?


Name the parts marked ‘A’ and ‘B’ in the given transcription unit:


If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.


The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.


DNA template sequence of CTGATAGC is transcribed over mRNA as ______.


Which is not involved in protein synthesis?


The process of copying genetic information from one strand of DNA to RNA is termed as ______.


In a cell, DNA transcription is halted when ______ 


Read the following and answer from given below:

The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.

Which ion is essential for the association of both units of the ribosome at the time of protein formation?


The process of copying genetic information from one strand of the DNA into RNA is termed as ______


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×