Advertisements
Advertisements
प्रश्न
A mRNA molecule is produced by ____________.
पर्याय
Replication
Transcription
Duplication
Translation
उत्तर
A mRNA molecule is produced by Transcription.
संबंधित प्रश्न
How do m-RNA, t-RNA and ribosomes help in the process of translation?
(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
State the aim and describe Messelson and Stahl’s experiment.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
What is the central dogma?
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Reverse transcriptase is ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
