Advertisements
Advertisements
Question
A mRNA molecule is produced by ____________.
Options
Replication
Transcription
Duplication
Translation
Solution
A mRNA molecule is produced by Transcription.
RELATED QUESTIONS
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the process of transcription in prokaryotes.
(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
State the aim and describe Messelson and Stahl’s experiment.
Briefly describe the following:
Transcription
How is Prokaryotic Transcription process different in eukaryotes?
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
