Advertisements
Advertisements
Question
Briefly describe the following:
Transcription
Solution
Transcription is the process of synthesis of RNA from DNA template. A segment of DNA gets copied into mRNA during the process. The process of transcription starts at the promoter region of the template DNA and terminates at the terminator region. The segment of DNA between these two regions is known as transcription unit. The transcription requires RNA polymerase enzyme, a DNA template, four types of ribonucleotides, and certain cofactors such as Mg2+.
The three important events that occur during the process of transcription are as follows.
(i) Initiation
(ii) Elongation
(iii) Termination
The DNA-dependent RNA polymerase and certain initiation factors (σ) bind at the double stranded DNA at the promoter region of the template strand and initiate the process of transcription. RNA polymerase moves along the DNA and leads to the unwinding of DNA duplex into two separate strands. Then, one of the strands, called sense strand, acts as template for mRNA synthesis. The enzyme, RNA polymerase, utilizes nucleoside triphosphates (dNTPs) as raw material and polymerizes them to form mRNA according to the complementary bases present on the template DNA. This process of opening of helix and elongation of polynucleotide chain continues until the enzyme reaches the terminator region. As RNA polymerase reaches the terminator region, the newly synthesized mRNA transcripted along with enzyme is released. Another factor called terminator factor (ρ) is required for the termination of the transcription.
APPEARS IN
RELATED QUESTIONS
(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.
State the aim and describe Messelson and Stahl’s experiment.
How is Prokaryotic Transcription process different in eukaryotes?
Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
What is the central dogma?
A mRNA molecule is produced by ____________.
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Reverse transcriptase is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
Which is not involved in protein synthesis?
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______