Advertisements
Advertisements
Question
What are introns?
Solution
Introns : Are the intervening sequences. Introns are non coding sections of a RNA transcript or the DNA encoding it that are spliced out before the RNA molecule is translated into a protein.
APPEARS IN
RELATED QUESTIONS
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Explain the process of transcription in prokaryotes.
State the aim and describe Messelson and Stahl’s experiment.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Reverse transcriptase is ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
