Advertisements
Advertisements
Question
How is the two stage process of protein synthesis advantageous?
Solution
The split gene feature of eukaryotic genes is almost entirely absent in prokaryotes. Originally each exon may have coded for a single polypeptide chain with a specific function. Since exon arrangement and intron removal are flexible, the exon coding for these polypeptide subunits act as domains combining in various ways to form new genes. Single genes can produce different functional proteins by arranging their exons in several different ways through alternate splicing patterns, a mechanism known to play an important role in generating both protein and functional diversity in animals.
Introns would have arose before or after the evolution of the eukaryotic gene. If introns arose late how did they enter the eukaryotic gene? Introns are mobile DNA sequences that can splice themselves out of, as well as into, specific ‘target sites’ acting like mobile transposon-like elements (that mediate transfer of genes between organisms - Horizontal Gene Transfer - HGT). HGT occurs between lineages of prokaryotic cells, or from prokaryotic to eukaryotic cells, and between eukaryotic cells. HGT is now hypothesized to have played a major role in the evolution of life on Earth.
RELATED QUESTIONS
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
State the aim and describe Messelson and Stahl’s experiment.
Briefly describe the following:
Transcription
Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
What is the central dogma?
A mRNA molecule is produced by ____________.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Reverse transcriptase is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______