Advertisements
Advertisements
Question
Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.
Solution
The precursor of mRNA, i.e. hnRNA, contains both introns and exons. Introns are removed and exons are joined by a process called splicing.
The remaining mRNA is processed in two ways:
(1) Capping: Methyl guanosine triphosphate is added to the 5′ end of hnRNA.
(2) Tailing: Adenylate residues are added to the 3′ end of hnRNA.
When hnRNA is fully processed, it is known as mRNA, which is transported out of the nucleus to get translated.
APPEARS IN
RELATED QUESTIONS
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Explain the role of initiator tRNA in the initiation of protein synthesis.
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
What is the central dogma?
What is the central dogma?
Which of the following is the correct sequence of event with reference to the central dogma?
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
