Advertisements
Advertisements
Question
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Solution
mRNA sequence is 3’ACGUACGUACGUUCGUACGUACGUACG5’.
RELATED QUESTIONS
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Describe the process of transcription in bacteria
Explain the process of transcription in prokaryotes.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Briefly describe the following:
Transcription
Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
What is the central dogma?
A mRNA molecule is produced by ____________.
Which of the following is the correct sequence of event with reference to the central dogma?
How is the two stage process of protein synthesis advantageous?
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
