Samacheer Kalvi solutions for Biology (Zoology) [English] Class 12 TN Board chapter 5 - Molecular Genetics [Latest edition]

Hershey and Chase experiment with bacteriophage showed that ____________.

DNA and RNA are similar with respect to ____________.

A mRNA molecule is produced by ____________.

The total number of nitrogenous bases in human genome is estimated to be about ____________.

E. coli cell grown on ¹⁵N medium are transferred to ¹⁴N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?

What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

Which of the following is the correct sequence of event with reference to the central dogma?

Which of the following statements about DNA replication is not correct?

Which of the following statements is not true about DNA replication in eukaryotes?

The first codon to be deciphered was __________ which codes for ________.

Meselson and Stahl’s experiment proved ____________.

Ribosomes are composed of two subunits; the smaller subunit of a ribosome has a binding site for _________ and the larger subunit has two binding sites for two __________.

An operon is a: ______

When lactose is present in the culture medium:

Give reasons: Genetic code is ‘universal’.

Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

Differentiate - Leading stand and lagging strand.

Differentiate between the following:

Template strand and Coding strand

Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

State any three goals of the human genome project.

In E.coli, three enzymes β- galactosidase, permease and transacetylase are produced in the presence of lactose. Explain why the enzymes are not synthesized in the absence of lactose.

Distinguish between structural gene, regulatory gene and operator gene.

A low level of expression of lac operon occurs at all the time. Justify the statement.

HGP is the window for the treatment of various genetic disorders. Justify the statement.

Why is the Human Genome project called a mega project?

From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?

Why tRNA is called an adapter molecule?

What are the three structural differences between RNA and DNA?

Name the anticodon required to recognize the following codon: AAU.

Name the anticodon required to recognize the following codon: CGA

Name the anticodon required to recognize the following codon: UAU

Name the anticodon required to recognize the following codon: GCA.

a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts

c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.

If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.

How is the two stage process of protein synthesis advantageous?

Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?

Explain the formation of a nucleosome.

It is established that RNA is the first genetic material. Explain giving three reasons.