English
Tamil Nadu Board of Secondary EducationHSC Science Class 12

From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation? - Zoology

Advertisements
Advertisements

Question

From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?

Answer in Brief

Solution

Inference of Watson and Crick on DNA replication:
They concluded that each of the DNA strand in a helix act as template during DNA replication leading to formation of new daughter DNA molecules, which are complementary to parental strand, (i.e., Semi-conservative method of replication).

Inference on coding capability:
During transcription, the genetic information in the DNA strand is coded to mRNA as complementary bases, (except for uracil in place of thymine in RNA).

Inference on mutation:
Any changes in the nucleotide sequence of DNA leads to corresponding alteration in aminoacid sequence of specific protein thus confirming the validity of genetic code.

shaalaa.com
DNA Replication
  Is there an error in this question or solution?
Chapter 5: Molecular Genetics - Evaluation [Page 86]

APPEARS IN

Samacheer Kalvi Biology (Zoology) [English] Class 12 TN Board
Chapter 5 Molecular Genetics
Evaluation | Q 26. | Page 86
Samacheer Kalvi Biology (Zoology) [English] Class 12 TN Board
Chapter 5 Molecular Genetics
Evaluation | Q 26. | Page 89

RELATED QUESTIONS

What is the function of an RNA primer during protein synthesis?


During DNA replication, the separated strands of DNA are prevented from recoiling by


Enlist the names of enzymes used in semiconservative replication of DNA?


What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?


Which of the following statements is not true about DNA replication in eukaryotes?


Meselson and Stahl’s experiment proved ____________.


DNA replication begins at specific sites situated on the molecule. Such sites are called ____________.


Match Column I with Column II and select the correct option among the following.

  Column I   Column II
i. DNA replication a. RNA polymerase
ii. Translation b. DNA polymerase
iii. Transcription c. Reverse transcriptase
iv. Reverse transcription d. t-RNA- amino acid complex

Which one of the following correctly represents the manner of replication of DNA?


Identify the CORRECT combination of statements with respect to DNA synthesis.

I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.

II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.

III. DNA polymerases on their own cannot initiate the process of replication.

IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.


Which of the following is present at the sticky ends of a fragmented DNA molecule?


Which of tbe following is generally used for creating density gradient during centrifugation?


When the DNA molecule appears like inverted Y, it is ______


"DNA is considered as genetic material" - Why?


Okazaki is known for his contribution to the under tanding of:


In viral DNA, how many origins of replication is/are present?


Characteristics unique to DNA are ______.


In the experiment of Meselson and Stahl, the heavy DNA was separated from light DNA by centrifugation in ______.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×