हिंदी
तमिलनाडु बोर्ड ऑफ सेकेंडरी एज्युकेशनएचएससी विज्ञान कक्षा १२

From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation? - Zoology

Advertisements
Advertisements

प्रश्न

From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability, and mutation?

संक्षेप में उत्तर

उत्तर

Inference of Watson and Crick on DNA replication:
They concluded that each of the DNA strand in a helix act as template during DNA replication leading to formation of new daughter DNA molecules, which are complementary to parental strand, (i.e., Semi-conservative method of replication).

Inference on coding capability:
During transcription, the genetic information in the DNA strand is coded to mRNA as complementary bases, (except for uracil in place of thymine in RNA).

Inference on mutation:
Any changes in the nucleotide sequence of DNA leads to corresponding alteration in aminoacid sequence of specific protein thus confirming the validity of genetic code.

shaalaa.com
DNA Replication
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८६]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 26. | पृष्ठ ८६
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 26. | पृष्ठ ८९

संबंधित प्रश्न

How CO2 makes idlies puffy?


Explain replication of bacteriophage with the help of a suitable diagram.


What is the function of an RNA primer during protein synthesis?


A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?


Enlist the names of enzymes used in semiconservative replication of DNA?


What are Okazaki fragments?


Differentiate - Leading stand and lagging strand.


a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts


c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.


Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.


Read the following statements and select the correct option.

i. The unit of DNA in which replication occurs, is called replicon.

ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.


Identify the CORRECT combination of statements with respect to DNA synthesis.

I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.

II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.

III. DNA polymerases on their own cannot initiate the process of replication.

IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.


Which of tbe following is generally used for creating density gradient during centrifugation?


Nucleolus is a major center for:


"DNA is considered as genetic material" - Why?


Wobble position means:


Characteristics unique to DNA are ______.


Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Torsional stress created during DNA replication is relieved by ______.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×