हिंदी

Science (English Medium) कक्षा १२ - CBSE Important Questions for Biology

Advertisements
[object Object]
[object Object]
विषयों
मुख्य विषय
अध्याय
Advertisements
Advertisements
Biology
< prev  101 to 120 of 960  next > 

Discuss the role the enzyme DNA ligase plays during DNA replication.

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: DNA Replication > The Experimental Proof

Name the transcriptionally active region of chromatin in a nucleus.

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Packaging of DNA Helix

Draw a diagrammatic sketch of a portion of DNA segment to support your answer.

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: DNA Replication > The Experimental Proof

Why is it not possible for an alien DNA to become part of a chromosome anywhere along its length and replicate normally?

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: DNA Replication > The Experimental Proof

Explain the process of making heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this process occur in the cell?

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Protein Synthesis > Types of RNA and the Process of Transcription

If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is 5' - ATGAATG - 3' the sequence of bases in its RNA transcript would be ______.

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Protein Synthesis > Transcription Unit

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Genetic Code

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Genetic Code

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Genetic Code

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Human Genome Project

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Appears in 3 question papers
Chapter: [0.05] Molecular Basis of Inheritance
Concept: Human Genome Project

What does the following equation represent? Explain.

p2 + 2pq + q2 = 1

Appears in 3 question papers
Chapter: [0.06] Evolution
Concept: Hardy Weinberg’s Principle

Describe the experiment that helped Louis Pasteur to dismiss the theory of spontaneous generation of life.

Appears in 3 question papers
Chapter: [0.06] Evolution
Concept: Theories of Origin of Life

Explain adaptive radiation with the help of a suitable example.

Appears in 3 question papers
Chapter: [0.06] Evolution
Concept: Theories of Biological Evolution > Adaptive Radiation

Mention the evolutionary significance of the Shrews

Appears in 3 question papers
Chapter: [0.06] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Lobefins

Appears in 3 question papers
Chapter: [0.06] Evolution
Concept: Evolution of Life Forms - a Theory

Mention the evolutionary significance of the Homo habilis

Appears in 3 question papers
Chapter: [0.06] Evolution
Concept: Evolution of Life Forms - a Theory

p2 + 2pq + q2 = 1. Explain this algebraic equation on the basis of Hardy Weinberg's principle.

Appears in 3 question papers
Chapter: [0.06] Evolution
Concept: Hardy Weinberg’s Principle

A heavily bleeding and bruised road accident victim was brought to a nursing home. The doctor immediately gave him an injection to protect him against a deadly disease.

(a) Write what did the doctor inject into the patient’s body.

(b) How do you think this injection would protect the patient against the disease?

(c) Name the disease against which this injection was given and the kind of immunity it provides.

Appears in 3 question papers
Chapter: [0.07] Human Health and Diseases
Concept: Immunity

Name any two types of cells that act as 'cellular barriers' to provide innate immunity in humans.

Appears in 3 question papers
Chapter: [0.07] Human Health and Diseases
Concept: Immunity
< prev  101 to 120 of 960  next > 
Advertisements
Advertisements
CBSE Science (English Medium) कक्षा १२ Important Questions
Important Questions for CBSE Science (English Medium) कक्षा १२ Biology
Important Questions for CBSE Science (English Medium) कक्षा १२ Chemistry
Important Questions for CBSE Science (English Medium) कक्षा १२ Computer Science (C++)
Important Questions for CBSE Science (English Medium) कक्षा १२ Computer Science (Python)
Important Questions for CBSE Science (English Medium) कक्षा १२ English Core
Important Questions for CBSE Science (English Medium) कक्षा १२ English Elective - NCERT
Important Questions for CBSE Science (English Medium) कक्षा १२ Entrepreneurship
Important Questions for CBSE Science (English Medium) कक्षा १२ Geography
Important Questions for CBSE Science (English Medium) कक्षा १२ Hindi (Core)
Important Questions for CBSE Science (English Medium) कक्षा १२ Hindi (Elective)
Important Questions for CBSE Science (English Medium) कक्षा १२ History
Important Questions for CBSE Science (English Medium) कक्षा १२ Informatics Practices
Important Questions for CBSE Science (English Medium) कक्षा १२ Mathematics
Important Questions for CBSE Science (English Medium) कक्षा १२ Physical Education
Important Questions for CBSE Science (English Medium) कक्षा १२ Physics
Important Questions for CBSE Science (English Medium) कक्षा १२ Political Science
Important Questions for CBSE Science (English Medium) कक्षा १२ Psychology
Important Questions for CBSE Science (English Medium) कक्षा १२ Sociology
Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×