Advertisements
Advertisements
प्रश्न
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
विकल्प
Phenylalanine, Methionine
Cysteine, Glycine
Alanine, Proline
Serine, Valine
उत्तर
Phenylalanine, Methionine
Explanation:
| 3' AUCAGGUUUGUGAUGGUACGA 5' | |
| ↑ | ↑ |
| Position | Position |
| 3 | 5 |
Codons UUU and AUG represent the amino acids phenylalanine and methionine, respectively. Therefore, during the process of translation, the amino acids phenylalanine and methionine would be merged at codon positions 3 and 5, accordingly.
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Give reasons: Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Select the incorrectly matched pair.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Which of the following organ is essential for photorespiration?
Genetic code translates the language of:
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
