Advertisements
Advertisements
Question
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Options
Phenylalanine, Methionine
Cysteine, Glycine
Alanine, Proline
Serine, Valine
Solution
Phenylalanine, Methionine
Explanation:
| 3' AUCAGGUUUGUGAUGGUACGA 5' | |
| ↑ | ↑ |
| Position | Position |
| 3 | 5 |
Codons UUU and AUG represent the amino acids phenylalanine and methionine, respectively. Therefore, during the process of translation, the amino acids phenylalanine and methionine would be merged at codon positions 3 and 5, accordingly.
APPEARS IN
RELATED QUESTIONS
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Degenerate and Initiator
Give reasons: Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: GCA.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Methionine carrying tRNA has anticodon:
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
Frame shift mutations are caused by ______.
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Discuss the process of translation in detail.
