Biology Outside Delhi Set 1 2022-2023 Science (English Medium) Class 12 Question Paper Solution

At which stage during evolution did human use hides to protect their bodies and buried their dead?

Homo habilis

Neanderthal man

Java man

Homo erectus

Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Choose the option where ART correctly matches with the procedure.

(A)-(i), B-(ii), (C)-(iii), (D)-(iv)

(A)-(iv), B-(i), (C)-(ii), (D)-(iii)

(A)-(iv), B-(iii), (C)-(i), (D)-(ii)

(A)-(i), B-(iii), (C)-(iv), (D)-(ii)

The decrease in the T-lymphocyte count in human blood will result in ______.

Decrease in antigens 

Decrease in antibodies

Increase in antibodies

Increase in antigens

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Phenylalanine, Methionine

Cysteine, Glycine

Alanine, Proline

Serine, Valine

A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of ______.

Commensalism

Parasitism

Amensalism

Mutualism

Select the pathogen mismatched with the symptoms of disease caused by it from the list given below:

Entamoeba histolytica: Constipation, abdominal pain

Epidermophyton: Dry scaly lesions on nail

Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb

Haemophilus influenzae: Blockage of the intestinal passage

The primary productivity in an ecosystem is expressed as ______.

1. gm^-2 yr^-1
2. gm^-2 yr
3. Kcal m^-2 yr^-1
4. Kcal m^-2

Given below is the restriction site of a restriction endonuclease Pst-I and the cleavage sites on a DNA molecule.

\[\ce{5' C - T - G - C - A \overset{\downarrow}{-}{G 3'}}\]

\[\ce{3' G\underset{\uparrow}{-} A - C - G - T - C 5'}\]

Choose the option that gives the correct resultant fragments by the action of the enzyme Pst-I.

The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including ______.

330 invertebrates

338 invertebrates

359 invertebrates

362 invertebrates

Given below are the list of the commercially important products and their source organisms. Select the option that gives the correct matches. 

(A) - (i), B - (ii), (C) - (iii), (D) - (iv)

(A) - (iii), B - (iv), (C) - (ii), (D) - (i)

(A) - (iv), B - (iii), (C) - (ii), (D) - (i)

(A) - (ii), B - (iv), (C) - (i), (D) - (iii)

Important attributes belonging to a population but not to an individual are:

1. Birth rate and death rate
2. Male and female
3. Birth and death
4. Sex-ratio

Select the correct option from the given options:

(i) only

(ii) only

(ii) and (iii)

(i) and (iv)

Select the option that shows the correctly identified 'U', 'X', 'Y' and 'Z' in a developing dicot embryo.

X - Plumule (2n), Y - Suspensor (n), Z - Cotyledon (2n), U - Radicle (2n).

X - Plumule (2n), Y - Suspensor (2n), Z- Radicle (2n), U - Cotyledon (2n).

X - Suspensor (2n), Y - Cotyledon (2n), Z - Radicle (2n), U - Plumule (2n).

X - Cotyledon (2n), Y - Radicle (n), Z - Plumule (n), U - Suspensor (n).

Assertion (A): Determining the sex of an unborn child followed by MTP is an illegal practice.

Reason (R): Amniocentesis is a practice to test the presence of genetic disorders also.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): Synthetic oligonucleotide polymers are used during Annealing in a PCR.

Reason (R): The primers bind to the double stranded DNA at their complementary regions.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): Decomposition process is slower if detritus is rich in lignin and cutin.

Reason (R): Decomposition is largely an oxygen requiring process.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): In Thalassemia an abnormal myoglobin chain is synthesized due to a gene defect.

Reason (R): α-Thalassemia is controlled by genes HBA-1 and HBA-2 on chromosome 16.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

The graph given below shows the number of primordial follicles per ovary in women at different ages. Study the graph and answer the questions that follow.

1. What is the average age of the women at the onset of menopause?
2. At what age are maximum primordial follicles present in the ovary, according to the given graph?

"Cattle and goats do not browse the Calotropis plant." Justify the statement giving reasons.

By using Punnett square depict the genotypes and phenotypes of test crosses (where green pod colour (G) is dominant over yellow pod colour (g)) in Garden pea with unknown genotype.

1. Give an example of a genus of virus used as narrow spectrum insecticidal biocontrol agent.
2. How does its use serve as an aid in overall integrated pest management programme?

Why is a malignant tumour considered to be more damaging than a benign tumour? Explain.

Write the scientific name of the source organism of the thermostable DNA polymerase used in PCR.

State the advantage of using Thermostable DNA polymerase.

Name and explain a surgical contraceptive method that can be adopted by the male partner of a couple.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Industrial melanism in England after 1850 is an excellent example of Natural selection. Explain how?

One of the major approaches of crop improvement programme is Artificial Hybridisation. Explain the steps involved in making sure that only the desired pollen grain pollinate the stigma of a bisexual flower by a plant breeder. 

“Plasmodium protozoan needs both a mosquito and a human host for its continuity.” Explain.

We all must work towards maintaining good health because ‘health is wealth'. Enlist any six ways of achieving good health.

On spraying Bacillus thuringiensis on an infected cotton crop field the pests are killed by the toxin, however the toxin although produced by the bacteria does not affect it. Explain giving reason.

"Biodiversity plays a major role in many ecosystem services that nature provides."

Describe any two broadly utilitarian arguments to justify the given statement.

"Biodiversity plays a major role in many ecosystem services that nature provides."

State one ethical reason for conserving biodiversity.

(a) In which period, according to the graph there are maximum chances of a person transmitting a disease/infection and why? (1)

(b) Study the graph and write what is an incubation period. Name a sexually transmitted disease that can be easily transmitted during this period. Name the specific type of lymphocytes that are attacked by the pathogen of this disease. (2)

OR

(b) Draw a schematic labelled diagram of an antibody. (2)

(c) In which period, the number of immune cells forming antibodies will be the highest in a person suffering from pneumonia? Name the immune cells that produce antibodies. (1)

(a) State what is aneuploidy. (1)

(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)

(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)

OR

(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)

Explain the monosporic development of the embryo sac in the ovule of an angiosperm.

Draw a diagram of the mature embryo sac of an angiospermic ovule and label any four parts in it.

Explain the formation of placenta after the implantation in a human female.

Draw a diagram showing human foetus within the uterus and label any four, parts in it.

Name and describe the steps involved in the technique widely used in forensics that serves as the basis of paternity testing in case of disputes.

It is sometimes observed that the F₁ progeny has a phenotype that does not resemble either of the two parents and has an intermediate phenotype. Explain by taking a suitable example and working out the cross upto F₂ progeny.

Bioreactors are the containment vehicles of any biotechnology-based production process. For large scale production and for economic reasons the final success of biotechnological process depends on the efficiency of the bioreactor.

Answer the following questions w.r.t. the given paragraph:

1. List the operational guidelines that must be adhered to so as to achieve optimisation of the bioreactor system. Enlist any four.
2. Mention the phase of the growth we refer to in the statement "Optimisation of growth and metabolic activity of the cells".
3. Is the biological product formed in the bioreactor suitable for the intended use immediate? Give reason in support of your answer.

'EcoRI' has played a very significant role in rDNA technology.

1. Explain the convention for naming EcoRI.
2. Write the recognition site and the cleavage sites of this restriction endonuclease.

What are the protruding and hanging stretches of DNA produced by these restriction enzymes called? Describe their role in the formation of rDNA.