English

Write the Contributions of the Following Scientists in Deciphering the Genetic Code. George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa - Biology

Advertisements
Advertisements

Question

Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa

Answer in Brief

Solution

George Gamow proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides. 

43 = 64 (42 = 16), which is less than 20; so, the codon was proposed to be a triplet.

Har Gobind Khorana developed a chemical method to synthesize RNA molecules with a defined combination of bases.

Marshall Nirenberg developed cell-free systems for protein synthesis, which helped the code to be deciphered.

Severo Ochoa discovered an enzyme (polynucleotide phosphorylase) which helped in the synthesis of RNA with defined sequences in a template-independent manner.

shaalaa.com
Genetic Code
  Is there an error in this question or solution?
2018-2019 (March) 57/1/1

RELATED QUESTIONS

Give an example of a codon having dual function.


Answer the following question.
State the importance of a Genetic code in protein biosynthesis.


Differentiate between the genetic codes given below:
Degenerate and Initiator


Name the anticodon required to recognize the following codon: AAU.


Name the anticodon required to recognize the following codon: UAU


Name the anticodon required to recognize the following codon: GCA.


One of the following is true with respect to AUG.


H. J. Muller was awarded Nobel Prize for his ______.


Amino acids which are specified by single codons are ______.


Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.


If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.


AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids: 

  Site A Site B
A. UAC Methionine
B. Methionine UAC
C. Methionine AUG
D. AUG Methionine

Genetic code translates the language of:


Methionine carrying tRNA has anticodon:


Genetic code was discovered by:


George Gamow suggested that each codon coding for an amino acid consists of ______


Genetic code is universal, it means ______


Which amino acid is determined by four genetic codes?


How many codons code for amino acid?


Frame shift mutations are caused by ______.


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


Statement I:

The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II:

‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.

In light of the above statements, choose the correct answer from the options given below.


Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×