Advertisements
Advertisements
प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
उत्तर
George Gamow proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides.
43 = 64 (42 = 16), which is less than 20; so, the codon was proposed to be a triplet.
Har Gobind Khorana developed a chemical method to synthesize RNA molecules with a defined combination of bases.
Marshall Nirenberg developed cell-free systems for protein synthesis, which helped the code to be deciphered.
Severo Ochoa discovered an enzyme (polynucleotide phosphorylase) which helped in the synthesis of RNA with defined sequences in a template-independent manner.
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
Differentiate between the genetic codes given below:
Degenerate and Initiator
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: UAU
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
H. J. Muller was awarded Nobel Prize for his ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Which of the following organ is essential for photorespiration?
Phenylalanine is a ______.
Percentage of mitochondrial DNA in the cell is:
Methionine carrying tRNA has anticodon:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
How many codons code for amino acid?
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'