Advertisements
Advertisements
प्रश्न
Name the anticodon required to recognize the following codon: AAU.
उत्तर
UUA
संबंधित प्रश्न
Give an example of a codon having dual function.
Give reasons: Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: CGA
Genetic code is ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Amino acids which are specified by single codons are ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
Which of the following organ is essential for photorespiration?
Genetic code translates the language of:
Genetic code was discovered by:
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
