मराठी

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation. - Biology

Advertisements
Advertisements

प्रश्न

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

पर्याय

  • Phenylalanine, Methionine

  • Cysteine, Glycine

  • Alanine, Proline

  • Serine, Valine

MCQ

उत्तर

Phenylalanine, Methionine

Explanation:

3' AUCAGGUUUGUGAUGGUACGA 5'
  ↑             ↑
Position Position
3             5

Codons UUU and AUG represent the amino acids phenylalanine and methionine, respectively. Therefore, during the process of translation, the amino acids phenylalanine and methionine would be merged at codon positions 3 and 5, accordingly.

shaalaa.com
Genetic Code
  या प्रश्नात किंवा उत्तरात काही त्रुटी आहे का?
2022-2023 (March) Outside Delhi Set 1

संबंधित प्रश्‍न

Give an example of a codon having dual function.


Answer the following question.
State the importance of a Genetic code in protein biosynthesis.


The first codon to be deciphered was __________ which codes for ________.


Give reasons: Genetic code is ‘universal’.


Name the anticodon required to recognize the following codon: CGA


Name the anticodon required to recognize the following codon: UAU


One of the following is true with respect to AUG.


DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?


Khorana first deciphered the triplet codons of ______.


Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.


The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.


H. J. Muller was awarded Nobel Prize for his ______.


Amino acids which are specified by single codons are ______.


Which out of the following statements is incorrect?


Some amino acids are coded by more than one codon, hence the genetic code is ______.


Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.


Genetic code translates the language of:


Methionine carrying tRNA has anticodon:


What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?


George Gamow suggested that each codon coding for an amino acid consists of ______


Genetic code is universal, it means ______


Which amino acid is determined by four genetic codes?


How many codons code for amino acid?


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.


Discuss the process of translation in detail.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×