Advertisements
Advertisements
प्रश्न
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
उत्तर
The genetic code is a set of three different nucleotides taken at a time that code for a specific amino acid.
- A codon is a triplet. 3 4 = 64 (61 codons code for amino acids while 3 are stop codons)
- One codon codes for a single specific amino acid. Codons are unambiguous.
- Codons are degenerate since some amino acids are coded by more than one codon.
- The genetic code is universal. 1 codon codes for the same amino acid in all species.
- Codons are read continuously. They lack punctuation.
- AUG has dual functions - Codes for Methionine and acts as a start codon
संबंधित प्रश्न
Give reasons: Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
H. J. Muller was awarded Nobel Prize for his ______.
Which out of the following statements is incorrect?
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Select the incorrectly matched pair.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Phenylalanine is a ______.
Genetic code translates the language of:
Methionine carrying tRNA has anticodon:
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
