हिंदी

Answer the Following Question. State the Importance of a Genetic Code in Protein Biosynthesis. - Biology

Advertisements
Advertisements

प्रश्न

Answer the following question.
State the importance of a Genetic code in protein biosynthesis.

संक्षेप में उत्तर

उत्तर

The genetic code is a set of three different nucleotides taken at a time that code for a specific amino acid.

  1. A codon is a triplet. 3 4 = 64 (61 codons code for amino acids while 3 are stop codons)  
  2. One codon codes for a single specific amino acid. Codons are unambiguous.  
  3. Codons are degenerate since some amino acids are coded by more than one codon.  
  4. The genetic code is universal. 1 codon codes for the same amino acid in all species.  
  5. Codons are read continuously. They lack punctuation.  
  6. AUG has dual functions - Codes for Methionine and acts as a start codon
shaalaa.com
Genetic Code
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
2018-2019 (March) 57/1/1

संबंधित प्रश्न

Give an example of a codon having dual function.


Differentiate between the genetic codes given below:
Unambiguous and Universal


The first codon to be deciphered was __________ which codes for ________.


Give reasons: Genetic code is ‘universal’.


Name the anticodon required to recognize the following codon: CGA


Name the anticodon required to recognize the following codon: UAU


Name the anticodon required to recognize the following codon: GCA.


Genetic code is ______.


Khorana first deciphered the triplet codons of ______.


Because most of the amino acids are represented by more than one codon, the genetic code is ______.


The number of base substitution possible in amino acid codons is ______.


Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.


Amino acids which are specified by single codons are ______.


Which out of the following statements is incorrect?


Some amino acids are coded by more than one codon, hence the genetic code is ______.


Select the incorrectly matched pair.


Which of the following organ is essential for photorespiration?


Phenylalanine is a ______.


What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?


George Gamow suggested that each codon coding for an amino acid consists of ______


Which amino acid is determined by four genetic codes?


How many codons code for amino acid?


Frame shift mutations are caused by ______.


Statement I:

The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II:

‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.

In light of the above statements, choose the correct answer from the options given below.


A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.


Discuss the process of translation in detail.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×