English

Answer the Following Question. State the Importance of a Genetic Code in Protein Biosynthesis. - Biology

Advertisements
Advertisements

Question

Answer the following question.
State the importance of a Genetic code in protein biosynthesis.

Answer in Brief

Solution

The genetic code is a set of three different nucleotides taken at a time that code for a specific amino acid.

  1. A codon is a triplet. 3 4 = 64 (61 codons code for amino acids while 3 are stop codons)  
  2. One codon codes for a single specific amino acid. Codons are unambiguous.  
  3. Codons are degenerate since some amino acids are coded by more than one codon.  
  4. The genetic code is universal. 1 codon codes for the same amino acid in all species.  
  5. Codons are read continuously. They lack punctuation.  
  6. AUG has dual functions - Codes for Methionine and acts as a start codon
shaalaa.com
Genetic Code
  Is there an error in this question or solution?
2018-2019 (March) 57/1/1

RELATED QUESTIONS

Give an example of a codon having dual function.


Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa


Differentiate between the genetic codes given below:
Unambiguous and Universal


Give reasons: Genetic code is ‘universal’.


Name the anticodon required to recognize the following codon: CGA


Name the anticodon required to recognize the following codon: UAU


Name the anticodon required to recognize the following codon: GCA.


Which out of the following statements is incorrect?


Some amino acids are coded by more than one codon, hence the genetic code is ______.


Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.


Select the incorrectly matched pair.


If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.


AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids: 

  Site A Site B
A. UAC Methionine
B. Methionine UAC
C. Methionine AUG
D. AUG Methionine

Which of the following organ is essential for photorespiration?


Phenylalanine is a ______.


Methionine carrying tRNA has anticodon:


Genetic code was discovered by:


What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?


Which amino acid is determined by four genetic codes?


Statement I:

The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II:

‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.

In light of the above statements, choose the correct answer from the options given below.


Discuss the process of translation in detail.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×