Advertisements
Advertisements
प्रश्न
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
उत्तर
Some amino acids are coded by more than one codon (known as degeneracy of codons), hence on deducing a nucleotide sequence from an amino acid sequence, multiple nucleotide sequence will be obtained. For e.g., Ile has three codous: AUU, AUC AUA hence a depeptide Met–Ile can have the following nucleotide sequence:
- AUG – AUU
- AUG – AUC
- AUG – AUA
and if, we deduce amino acid sequence for the above nucleotide sequences, all the three will code for Met–Ile
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Unambiguous and Universal
Differentiate between the genetic codes given below:
Degenerate and Initiator
The first codon to be deciphered was __________ which codes for ________.
Name the anticodon required to recognize the following codon: GCA.
Genetic code is ______.
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Amino acids which are specified by single codons are ______.
Select the incorrectly matched pair.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Which of the following organ is essential for photorespiration?
Methionine carrying tRNA has anticodon:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Frame shift mutations are caused by ______.
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
