Advertisements
Advertisements
प्रश्न
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
उत्तर
The statement is correct. Because of degeneracy of codons, mutations at third base of codon, usually does not result into any change in phenotype. This is called silent mutations.
APPEARS IN
संबंधित प्रश्न
Give an example of a codon having dual function.
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Unambiguous and Universal
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: UAU
Name the anticodon required to recognize the following codon: GCA.
Frame shift mutation occurs when ______.
Khorana first deciphered the triplet codons of ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Which of the following organ is essential for photorespiration?
Phenylalanine is a ______.
Percentage of mitochondrial DNA in the cell is:
Genetic code was discovered by:
Genetic code is universal, it means ______
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
