Advertisements
Advertisements
प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
उत्तर
Unambiguous and Universal:
| Unambiguous | Universal: |
|
The code is specific, i.e. one condon codes for only one amino acid. |
The code is the same in all organisms. |
APPEARS IN
संबंधित प्रश्न
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Differentiate between the genetic codes given below:
Degenerate and Initiator
The first codon to be deciphered was __________ which codes for ________.
Give reasons: Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
Frame shift mutation occurs when ______.
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Which out of the following statements is incorrect?
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Phenylalanine is a ______.
Genetic code translates the language of:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
How many codons code for amino acid?
Frame shift mutations are caused by ______.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
