Advertisements
Advertisements
Question
Differentiate between the genetic codes given below:
Degenerate and Initiator
Solution
Degenerate and Initiator:
| Degenerate | Initiator |
| when an amino acid is coded by more than one codon, it is said to be degenerate. | AUG is an initiator codon i.e. it initiates the translation process & also codes for methionine. |
APPEARS IN
RELATED QUESTIONS
Give an example of a codon having dual function.
Differentiate between the genetic codes given below:
Unambiguous and Universal
The first codon to be deciphered was __________ which codes for ________.
Give reasons: Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Select the incorrectly matched pair.
Which amino acid is determined by four genetic codes?
Frame shift mutations are caused by ______.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
