Advertisements
Advertisements
Question
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Solution
The defect is caused by the substitution (trans version) of Glutamic acid (Glu) by Valine (Val) at the sixth position of the betaglobin chain of the haemoglobin molecule. The substitution of amino acid in the glob in protein results due to the single base substitution at the sixth codon of the betaglobin gene from GAG to GUG. The mutant haemoglobin molecule undergoes polymerisation under low oxygen tension causing the change in the shape of the RBC from biconcave disc to elongated sickle-like structure. Sickle-shaped red blood cells that obstruct capillaries and restrict blood flow to an organ resulting in ischaemia, pain, necrosis, and often organ damage.
APPEARS IN
RELATED QUESTIONS
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: UAU
Khorana first deciphered the triplet codons of ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Phenylalanine is a ______.
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
How many codons code for amino acid?
Frame shift mutations are caused by ______.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
