Biology Outside Delhi Set 2 2022-2023 Science (English Medium) Class 12 Question Paper Solution

Interferons are proteins. In humans they are secreted by ______.

Thymus gland

B-lymphocytes

Viral infected cells

Tonsils

Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Choose the option where ART correctly matches with the procedure.

(A)-(i), B-(ii), (C)-(iii), (D)-(iv)

(A)-(iv), B-(i), (C)-(ii), (D)-(iii)

(A)-(iv), B-(iii), (C)-(i), (D)-(ii)

(A)-(i), B-(iii), (C)-(iv), (D)-(ii)

The decrease in the T-lymphocyte count in human blood will result in ______.

Decrease in antigens 

Decrease in antibodies

Increase in antibodies

Increase in antigens

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Phenylalanine, Methionine

Cysteine, Glycine

Alanine, Proline

Serine, Valine

Given below are four aspects of Reproductive Health in Column A and their related information in Column B:

Select the correct match from the following options:

(A)-(iv), B-(ii), (C)-(iii), (D)-(i)

(A)-(ii), B-(i), (C)-(iv), (D)-(iii)

(A)-(i), B-(iii), (C)-(ii), (D)-(iv)

(A) (ii), B-(i), (C)-(iii), (D)-(iv)

Select the pathogen mismatched with the symptoms of disease caused by it from the list given below:

Entamoeba histolytica: Constipation, abdominal pain

Epidermophyton: Dry scaly lesions on nail

Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb

Haemophilus influenzae: Blockage of the intestinal passage

The primary productivity in an ecosystem is expressed as ______.

1. gm^-2 yr^-1
2. gm^-2 yr
3. Kcal m^-2 yr^-1
4. Kcal m^-2

Interaction between clown fish living among the stinging tentacles of sea anemone is an example of ______.

Amensalism

Parasitism

Mutualism

Commensalism

The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including ______.

330 invertebrates

338 invertebrates

359 invertebrates

362 invertebrates

Which one of the following groups faces maximum threat of extinction? 

Gymnosperm

Birds

Amphibian

Mammals

Important attributes belonging to a population but not to an individual are:

1. Birth rate and death rate
2. Male and female
3. Birth and death
4. Sex-ratio

Select the correct option from the given options:

(i) only

(ii) only

(ii) and (iii)

(i) and (iv)

Select the option that shows the correctly identified 'U', 'X', 'Y' and 'Z' in a developing dicot embryo.

X - Plumule (2n), Y - Suspensor (n), Z - Cotyledon (2n), U - Radicle (2n).

X - Plumule (2n), Y - Suspensor (2n), Z- Radicle (2n), U - Cotyledon (2n).

X - Suspensor (2n), Y - Cotyledon (2n), Z - Radicle (2n), U - Plumule (2n).

X - Cotyledon (2n), Y - Radicle (n), Z - Plumule (n), U - Suspensor (n).

Assertion (A): Determining the sex of an unborn child followed by MTP is an illegal practice.

Reason (R): Amniocentesis is a practice to test the presence of genetic disorders also.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): Synthetic oligonucleotide polymers are used during Annealing in a PCR.

Reason (R): The primers bind to the double stranded DNA at their complementary regions.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): Decomposition process is slower if detritus is rich in lignin and cutin.

Reason (R): Decomposition is largely an oxygen requiring process.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): In Thalassemia an abnormal myoglobin chain is synthesized due to a gene defect.

Reason (R): α-Thalassemia is controlled by genes HBA-1 and HBA-2 on chromosome 16.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

State the principle involved in separation of DNA fragments using gel electrophoresis.

How are DNA fragments visualised once they are separated by gel electrophoresis?

1. Give an example of a genus of fungi that forms mycorhizal association with plants. 
2. How does the plant derive benefits from this association?

Name any two techniques used to detect the cancer of internal organs and write about any one of them.

By using Punnett square depict the genotypes and phenotypes of test crosses (where green pod colour (G) is dominant over yellow pod colour (g)) in Garden pea with unknown genotype.

"Abingdon tortoise in Galapagos islands became extinct within a decade on introduction of goats in the island." Explain giving reason.

Write the scientific name of the source organism of the thermostable DNA polymerase used in PCR.

State the advantage of using Thermostable DNA polymerase.

Explain how did the experiment conducted by S.L. Miller substantiate that life evolved from preexisting nonliving organic molecules.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Industrial melanism in England after 1850 is an excellent example of Natural selection. Explain how?

One of the major approaches of crop improvement programme is Artificial Hybridisation. Explain the steps involved in making sure that only the desired pollen grain pollinate the stigma of a bisexual flower by a plant breeder. 

“Plasmodium protozoan needs both a mosquito and a human host for its continuity.” Explain.

We all must work towards maintaining good health because ‘health is wealth'. Enlist any six ways of achieving good health.

Eli Lilly's contribution for diabetic patients through r-DNA technology has been overwhelmingly accepted. Explain how?

"Biodiversity plays a major role in many ecosystem services that nature provides."

Describe any two broadly utilitarian arguments to justify the given statement.

"Biodiversity plays a major role in many ecosystem services that nature provides."

State one ethical reason for conserving biodiversity.

(a) In which period, according to the graph there are maximum chances of a person transmitting a disease/infection and why? (1)

(b) Study the graph and write what is an incubation period. Name a sexually transmitted disease that can be easily transmitted during this period. Name the specific type of lymphocytes that are attacked by the pathogen of this disease. (2)

OR

(b) Draw a schematic labelled diagram of an antibody. (2)

(c) In which period, the number of immune cells forming antibodies will be the highest in a person suffering from pneumonia? Name the immune cells that produce antibodies. (1)

(a) State what is aneuploidy. (1)

(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)

(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)

OR

(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)

Explain the monosporic development of the embryo sac in the ovule of an angiosperm.

Draw a diagram of the mature embryo sac of an angiospermic ovule and label any four parts in it.

Explain the formation of placenta after the implantation in a human female.

Draw a diagram showing human foetus within the uterus and label any four, parts in it.

"It is sometimes observed that the F₁ progeny shows a phenotype that resembles both the parents." Explain this type of inheritance using the example of A, B, and O blood groups in human.

Explain the process of aminoacylation of tRNA and its role in the process of translation.

How does initiation of the translation process occur in prokaryotes? Explain.

Where are the untranslated regions located on mRNA and why?

Bioreactors are the containment vehicles of any biotechnology-based production process. For large scale production and for economic reasons the final success of biotechnological process depends on the efficiency of the bioreactor.

Answer the following questions w.r.t. the given paragraph:

1. List the operational guidelines that must be adhered to so as to achieve optimisation of the bioreactor system. Enlist any four.
2. Mention the phase of the growth we refer to in the statement "Optimisation of growth and metabolic activity of the cells".
3. Is the biological product formed in the bioreactor suitable for the intended use immediate? Give reason in support of your answer.

'EcoRI' has played a very significant role in rDNA technology.

1. Explain the convention for naming EcoRI.
2. Write the recognition site and the cleavage sites of this restriction endonuclease.

What are the protruding and hanging stretches of DNA produced by these restriction enzymes called? Describe their role in the formation of rDNA.