Biology Outside Delhi Set 3 2022-2023 Science (English Medium) Class 12 Question Paper Solution

At which stage during evolution did human use hides to protect their bodies and buried their dead?

Homo habilis

Neanderthal man

Java man

Homo erectus

Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Choose the option where ART correctly matches with the procedure.

(A)-(i), B-(ii), (C)-(iii), (D)-(iv)

(A)-(iv), B-(i), (C)-(ii), (D)-(iii)

(A)-(iv), B-(iii), (C)-(i), (D)-(ii)

(A)-(i), B-(iii), (C)-(iv), (D)-(ii)

Many copepods live on the body surface of marine fish. This relationship is an example of ______.

Commensalism

Parasitism

Amensalism

Mutualism

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Phenylalanine, Methionine

Cysteine, Glycine

Alanine, Proline

Serine, Valine

A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of ______.

Commensalism

Parasitism

Amensalism

Mutualism

Given below are the structural details of a human mammary gland:

1. The glandular tissue in the breast has 15-20 clusters. of cells called alveoli.
2. The milk is stored in the lumen of the alveoli.
3. The alveoli join to form the mammary ducts.
4. Mammary ampulla is connected to lactiferous ducts.

Choose the option that gives the correct detail of the human mammary gland.

(i) and (ii)

(ii) and (iii)

(ii) and (iv)

(i) and (iii)

The primary productivity in an ecosystem is expressed as ______.

1. gm^-2 yr^-1
2. gm^-2 yr
3. Kcal m^-2 yr^-1
4. Kcal m^-2

Tetanus antitoxin (Tetanus toxoid) when injected into the human body it immediately provides ______.

Innate immunity

Passive immunity

Auto immunity

Active immunity

The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including ______.

330 invertebrates

338 invertebrates

359 invertebrates

362 invertebrates

Given below are the list of the commercially important products and their source organisms. Select the option that gives the correct matches. 

(A) - (i), B - (ii), (C) - (iii), (D) - (iv)

(A) - (iii), B - (iv), (C) - (ii), (D) - (i)

(A) - (iv), B - (iii), (C) - (ii), (D) - (i)

(A) - (ii), B - (iv), (C) - (i), (D) - (iii)

The sixth extinction in progress currently is different from all previous extinctions on earth as it is ______.

10-100 times faster

100-1000 times faster

100-10000 times faster

1000-10000 times faster

Select the option that shows the correctly identified 'U', 'X', 'Y' and 'Z' in a developing dicot embryo.

X - Plumule (2n), Y - Suspensor (n), Z - Cotyledon (2n), U - Radicle (2n).

X - Plumule (2n), Y - Suspensor (2n), Z- Radicle (2n), U - Cotyledon (2n).

X - Suspensor (2n), Y - Cotyledon (2n), Z - Radicle (2n), U - Plumule (2n).

X - Cotyledon (2n), Y - Radicle (n), Z - Plumule (n), U - Suspensor (n).

Assertion (A): Determining the sex of an unborn child followed by MTP is an illegal practice.

Reason (R): Amniocentesis is a practice to test the presence of genetic disorders also.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): Synthetic oligonucleotide polymers are used during Annealing in a PCR.

Reason (R): The primers bind to the double stranded DNA at their complementary regions.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): Decomposition process is slower if detritus is rich in lignin and cutin.

Reason (R): Decomposition is largely an oxygen requiring process.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Assertion (A): In Thalassemia an abnormal myoglobin chain is synthesized due to a gene defect.

Reason (R): α-Thalassemia is controlled by genes HBA-1 and HBA-2 on chromosome 16.

Both (A) and (R) are true and (R) is the correct explanation of (A)

Both (A) and (R) are true, but (R) is not the correct explanation of (A)

(A) is true, but (R) is false

(A) is false, but (R) is true

Name (i) a GM cereal crop having enhanced nutritional value, (ii) the nutrient it is rich in.

State any two benefits of Genetically modified crops.

"Cattle and goats do not browse the Calotropis plant." Justify the statement giving reasons.

Certain specific bacterial spores are mixed in water and sprayed over Brassica crop to control butterfly caterpillars.

Name this bacterium and its mode of action on the butterfly caterpillars.

Immunotherapy these days is one of the most efficient ways of treatment of cancer. The therapy involved activates the immune system and destroys the tumour.

1. Write an example of one such biological response modifier used in immunotherapy.
2. Why do patients need such substances if immune system is already working in body?
3. State what is 'Contact inhibition'.

1. Give an example of a genus of virus used as narrow spectrum insecticidal biocontrol agent.
2. How does its use serve as an aid in overall integrated pest management programme?

Why is a malignant tumour considered to be more damaging than a benign tumour? Explain.

"Some species of insects and frogs have evolved with various specific features that help them from being detected."

1. Justify the statement giving reasons.
2. Mention any two such features.

Name and explain a surgical contraceptive method that can be adopted by the male partner of a couple.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

Industrial melanism in England after 1850 is an excellent example of Natural selection. Explain how?

One of the major approaches of crop improvement programme is Artificial Hybridisation. Explain the steps involved in making sure that only the desired pollen grain pollinate the stigma of a bisexual flower by a plant breeder. 

“Plasmodium protozoan needs both a mosquito and a human host for its continuity.” Explain.

We all must work towards maintaining good health because ‘health is wealth'. Enlist any six ways of achieving good health.

Mention Darwin's observations made on finches during his visit of Galapagos Islands. Write the explanation given by Darwin on his observations.

"RNA interference has been used to produce transgenic tobacco plants to protect them from the infestation by specific nematodes." Explain the novel strategy exploited by the biotechnologists.

(a) In which period, according to the graph there are maximum chances of a person transmitting a disease/infection and why? (1)

(b) Study the graph and write what is an incubation period. Name a sexually transmitted disease that can be easily transmitted during this period. Name the specific type of lymphocytes that are attacked by the pathogen of this disease. (2)

OR

(b) Draw a schematic labelled diagram of an antibody. (2)

(c) In which period, the number of immune cells forming antibodies will be the highest in a person suffering from pneumonia? Name the immune cells that produce antibodies. (1)

(a) State what is aneuploidy. (1)

(b) If during spermatogenesis, the chromatids of sex chromosomes fail to segregate during meiosis, write only the different types of gametes with altered chromosome numbers that could possibly be produced. (1)

(c) A normal human sperm (22 + Y) fertilises an ovum with karyotype '22 +XX'. Name the disorder the offspring thus produced would suffer from and write any two symptoms of the disorder. (2)

OR

(c) Name the best-known and most common autosomal aneuploid abnormality in humans and write any two symptoms. (2)

Explain the process of aminoacylation of tRNA and its role in the process of translation.

List two essential roles of ribosome during translation.

Explain the process of binding of ribosomal units to mRNA during protein synthesis.

Describe the dihybrid cross upto F₂ generation as conducted by Gregor Mendel using pure lines of Garden Pea for characters-seed shape and seed colour.

Name and describe the steps involved in the technique widely used in forensics that serves as the basis of paternity testing in case of disputes.

It is sometimes observed that the F₁ progeny has a phenotype that does not resemble either of the two parents and has an intermediate phenotype. Explain by taking a suitable example and working out the cross upto F₂ progeny.

Bioreactors are the containment vehicles of any biotechnology-based production process. For large scale production and for economic reasons the final success of biotechnological process depends on the efficiency of the bioreactor.

Answer the following questions w.r.t. the given paragraph:

1. List the operational guidelines that must be adhered to so as to achieve optimisation of the bioreactor system. Enlist any four.
2. Mention the phase of the growth we refer to in the statement "Optimisation of growth and metabolic activity of the cells".
3. Is the biological product formed in the bioreactor suitable for the intended use immediate? Give reason in support of your answer.

'EcoRI' has played a very significant role in rDNA technology.

1. Explain the convention for naming EcoRI.
2. Write the recognition site and the cleavage sites of this restriction endonuclease.

What are the protruding and hanging stretches of DNA produced by these restriction enzymes called? Describe their role in the formation of rDNA.