Advertisements
Advertisements
प्रश्न
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
पर्याय
One high and one low density band.
One intermediate density band.
One high and one intermediate density band.
One low and one intermediate density band.
उत्तर
One low and one intermediate density band.
संबंधित प्रश्न
How CO2 makes idlies puffy?
_______ enzymes are used as biological scissors in r-DNA technology.
(A) Restriction endonucleases
(B) DNA ligases
(C) DNA polymerases
(D) Reverse transcriptases
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
Very Short Answer Question:
Why are Okazaki fragments formed on lagging strand only?
Semiconservative mechanism of DNA was detected using:
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
What are Okazaki fragments?
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Which of the following term correctly describes the movement of ribosome on the mRNA?
Which of tbe following is generally used for creating density gradient during centrifugation?
The addition of nucleotides on the lagging strand occurs ____________ during DNA replication.
Nucleolus is a major center for:
Wobble position means:
Identify the biomolecule that is capable of self-replication.
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
Select the incorrect statement regarding DNA replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
