Advertisements
Advertisements
प्रश्न
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
विकल्प
Remove/Replace 3' OH group in deoxy ribose
Remove/Replace 2' OH group with some other group in deoxy ribose
Both ‘B’ and ‘C’
Replace purine with pyrimidines
उत्तर
Remove/Replace 3' OH group in deoxy ribose
APPEARS IN
संबंधित प्रश्न
Give an example of a codon having dual function.
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Unambiguous and Universal
Differentiate between the genetic codes given below:
Degenerate and Initiator
The first codon to be deciphered was __________ which codes for ________.
Give reasons: Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: CGA
Frame shift mutation occurs when ______.
Khorana first deciphered the triplet codons of ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
Genetic code is universal, it means ______
Frame shift mutations are caused by ______.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
