Advertisements
Advertisements
प्रश्न
If the sequence of one strand of DNA is written as follows:
5' -ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction.
उत्तर
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5'→3' direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in the 5'→3' direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3
APPEARS IN
संबंधित प्रश्न
If the sequence of the coding strand in a transcription unit is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of mRNA.
Differentiate between the following:
Template strand and Coding strand
Control of gene expression in prokaryotes takes place at the level of ______.
The RNA polymerase holoenzyme transcribes ______.
Which of the following steps in transcription is catalysed by RNA polymerase?
If the sequence of bases in DNA is GCTTAGGCAA then the sequence of bases in its transcript will be ______.
Transcription unit ______.
During transcription, the site of DNA molecule at which RNA polymerase binds is called ______.
In biochemical genetics the term gene is being replaced by ______.
Read the following and answer from given below:
The process of copying genetic information from the template strand of DNA into RNA is called transcription. It is mediated by RNA polymerase. Transcription takes place in the nucleus of eukaryotic cells. In transcription, only a segment of DNA and only one of the strands is copied into RNA.
What are regions of the transcription unit in a DNA molecule?
Which of the following DNA sequences qualifies is designated as a palindrome?
In a DNA segment, all of the following are region of transcription unit except ______.
Given below is the sequence of coding strand of DNA in a transcription unit 3 'A A T G C A G C T A T T A G G – 5’ write the sequence of its complementary strand
Given below is the sequence of coding strand of DNA in a transcription unit 3 'A A T G C A G C T A T T A G G – 5’ write the sequence of the mRNA
