Advertisements
Advertisements
प्रश्न
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
उत्तर
(A) - Promoter site
(B) - Structural gene
संबंधित प्रश्न
Describe the process of transcription in bacteria
State the aim and describe Messelson and Stahl’s experiment.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA eukaryotes.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to:
(i) RNA molecule
(ii) Second DNA molecule
(iii) Ribosomal sub unit·
(iv) Sequence of amino acids in a protein molecule
Initiation codon of protein synthesis in Eukaryotes is ______.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ____________.
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Reverse transcriptase is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______