Science (English Medium) Class 12 - CBSE Important Questions for Biology

Discuss the role the enzyme DNA ligase plays during DNA replication.

Name the transcriptionally active region of chromatin in a nucleus.

Draw a diagrammatic sketch of a portion of DNA segment to support your answer.

Why is it not possible for an alien DNA to become part of a chromosome anywhere along its length and replicate normally?

Explain the process of making heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this process occur in the cell?

If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is 5' - ATGAATG - 3' the sequence of bases in its RNA transcript would be ______.

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Enlist any four prime goals of HGP.

Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals.

Name any one common non-human animal model organism which has also been sequenced thereafter.

What does the following equation represent? Explain.

p² + 2pq + q² = 1

Describe the experiment that helped Louis Pasteur to dismiss the theory of spontaneous generation of life.

Explain adaptive radiation with the help of a suitable example.

Mention the evolutionary significance of the Shrews

Mention the evolutionary significance of the Lobefins

Mention the evolutionary significance of the Homo habilis

p² + 2pq + q² = 1. Explain this algebraic equation on the basis of Hardy Weinberg's principle.

A heavily bleeding and bruised road accident victim was brought to a nursing home. The doctor immediately gave him an injection to protect him against a deadly disease.

(a) Write what did the doctor inject into the patient’s body.

(b) How do you think this injection would protect the patient against the disease?

(c) Name the disease against which this injection was given and the kind of immunity it provides.

Name any two types of cells that act as 'cellular barriers' to provide innate immunity in humans.